Seconda Prova Intercorso 16 dicembre 2009 Rispondete alle

advertisement
Seconda Prova Intercorso 16 dicembre 2009
Rispondete alle domande ed inviate via e-mail ([email protected]) il file compilato
1. Riportare di seguito un allineamento multiplo di 6 sequenze proteiche che sono presenti in
Uniprot/SwissProt per la proteina IL-6.
Scrivere gli accession number delle 6 sequenze scelte:
Indicare quale residuo è più frequente in posizione 21 ed il nome del programma usato?
Inserire la tabella con le percentuali di identità di sequenza tra le 6 sequenze.
Costruire un albero filogenetico con radice delle sequenze proteiche.
2. Dato il seguente frammento genomico:
TCACCCTCACCCTCACCCTCACCCTCACCCTCACCCTAACCCTACCCTAACCCCTAACC
CCTAACCCCTAACCCCTAACCCTTAACCCTAACCCTAACCCTACCCTAACCCTAACCCT
AACCCCTAACCCCTAACCCCTAA
Ricercare in Ensembl/human su quale cromosoma è localizzato:
3. Ricercare la sequenza di IL-6 di cane (IL-6 dog) in UniProt/SwissProt.
Scrivere l’ Accession Number:
Scrivere il Peso Molecolare ed il nome del programma usato:
Scrivere il Punto isoelettrico ed il nome del programma usato:
Scrivere il numero di residui carichi positivamente ed il nome del programma usato:
Valutare dove l’IL-6 di cane è localizzata nella cellula mediante PSORT II:
4. Predire la struttura secondaria della sequenza di IL-6 di cane mediante Chou&Fasman e JPred3.
Scrivere il nome di un programma per predire il disordine e predire la propensità al disordine di IL6 di cane?
5. Predire la struttura tridimensionale della sequenza di IL-6 di cane mediante SWISSMODEL.
Scrivere il nome ed il codice PDB della proteina usata come riferimento nel modellamento:
Scrivere lo Z-score calcolato da Prosa per il modello ottenuto e per la struttura usata come
riferimento nel modellamento.
6. Ricercare il file PDB 1JL4.
Scrivere il numero di residui della catena A che interagiscono con la catena D ed il nome del
programma usato:
Scrivere il numero di legami ad idrogeno:
Scrivere il numero di ponti disolfuro:
Scrivere il numero di ponti salini:
Scrivere l’energia di binding tra la catena A e la catena D ed il nome del programma usato:
7. Data la seguente sequenza nucleotidica, predire il numero di geni contenuti in essa.
CTGTCAAGCCCAAGCCTCTCCGGGAGACGAGTACACCATCCTGGGTCGGACTNNNGGCTNNGGCACCAAACACTGGGTAA
GTGTGGAACGAGCTGCTCCTCGGGACACGGTGATGTCATCTAAACGCTCCTGTTCCTCAGGTAACTGAAGAGTCTCTGGT
CTACACAAACCTCCTCATATTCTCACCTCGAGTGACTCAGGACGGGCTCATTCGAATGGACGAAGCCGTCATTCCGATCG
AGTGCCAGTATGAAAGGTGCTTCTCCTGTCTATTAAATTCAAAGACGCCTCTGCTGCCGCTCACGTGTACCATGTCTCCT
CAGGAAGTACAGCCTGTCCAGCGGCTCCCTCAAGCCCACCTGGATCCCTTTCATGTCCACCCAAGCTGCGGTGGAAAACC
TGTCCTTTGACATGAAGCTTGTGTCGGGTGAGTTTTTGGCTGGCCTTAAACACTTGCTCAAACTGTACACGCCAACTACT
CCTGTTTCAGATGACTGGAACTACGAAAGAGGCTCCAACGTGTTTCACCTGGGGACCTCATCCCTGTGGAGGCCTCGGTC
AGAGTTGGGCACCACCTGGGCCTCCGGGTGTTTGTGAGCAGCTGCACGGCCACGCTTTCCCCGGACGCCCTCTCCCATC
CCAGACACGTCTTCATCGAAAATGGGTAAACGTCAGCTTGGCTCCCAGTGTTGTGGTCTGAATCTGGGGGAGGAGCTTGT
GAGGACTGAACTGTCAGGTTTGAGGTTCTTGACCCATTTCTGGCTCTTGTCGTAGGTGCTTCACTGACTCTCAGCTTCCA
GATTCAAAGTCTCAGTTCTTCCCGAGGATTCAGGATGAGAAGCTCCACATGGTCATCGGCGCCTTCAGGTTCCATAACCA
GGACAGCGGCGAGGTTTGACTCGGTTTGGTAAATCTCTCCCAGCTGTGTCTCCCTCATAAAGGCACGACCCGTCTCTCCC
GCAGCTCTACATCACATGTCACCTGACCGCTGTACCAACCAATGACCCAGAGGCACTGCCTAAGGCCTGCACATTTATGA
ACGGAAGGCAAGTGGCGCGTTGGAGACATCATTTTTAAACGGACTCGGAATAAAACTATCTATTTCCAGGTGGCGTTCGG
CCGACGGCAACGATTACTCGTGTGCCAACTGTCAGACCCACGGCGGCGCCGGTCACACCAGTCACACGAAACCCAGCACT
CCAGCCAAGTTTGGCCCTCGTGGCTTCGGGAAGCCAGAAAAACCGTGGAAGAGCATCGCCAAGACAAAAATGCGTAAGTT
CAATGACGCC
Scrivere il numero di geni predetti ed il programma usato:
8. Dato il seguente gene:
gctctcgtccacaagtatcactacgcg
Scrivere la traduzione di questa sequenza in una sequenza amminoacidica:
Scrivere la sequenza nucleotidica e la traduzione in sequenza amminoacidica per un
cambiamento di una singola base che non produce una mutazione di un amminoacido.
Scrivere la sequenza nucleotidica e la traduzione in sequenza amminoacidica per un
cambiamento di una singola base che produca una mutazione di un amminoacido.
9. Valutare la distanza di Hamming tra le due sequenze proteiche:
AGTCTDCAGAYPH
CGGTCDGTCADPH
10.Valutare la distanza di Levenshtein tra le due sequenze proteiche:
VSLIDTRKVHDFYEG
GSI-GTIK-HTGYHL
Scarica