Articolo 1 FTP-LAMP

Journal of Microbiological Methods 175 (2020) 105992
Contents lists available at ScienceDirect
Journal of Microbiological Methods
journal homepage: www.elsevier.com/locate/jmicmeth
Development of an FTP-LAMP assay based on TaqMan real-time PCR and
LAMP for the specific detection of Xylella fastidiosa De Donno and mulberry
strains in both plants and insect vectors
T
⁎
Toufic Elbeainoa, , Ornella Incertia, Hiba Dakrouba, Franco Valentinia, Qi Huangb
a
b
Istituto Agronomico Mediterraneo di Bari, Via Ceglie 9, 70010 Valenzano, BA, Italy
Floral and Nursery Plants Research Unit, Agricultural Research Service, United States Department of Agriculture, Beltsville, MD, United States
A R T I C LE I N FO
A B S T R A C T
Keywords:
Xylella fastidiosa
Philaenus spumarius
Neophilaenus campestris
Singleplex and duplex real-time detection
LAMP and FTP-LAMP
We developed two real-time detection assays, TaqMan real-time PCR and LAMP, using primers and probe designed based on a sequence annotated to code for a Haemagglutinin-related protein (Hg) of Xylella fastidiosa (Xf),
a gene uniquely present in the Italian olive (De Donno of olive) and American mulberry strains, for specific
detection of the target Xf strains. These assays were validated with DNA samples extracted from Xf-infected plant
samples and from two species of insect vectors (Philaenus spumarius, Ps; and Neophilaenus campestris, Nc). Both
techniques were proven to be highly sensitive (100 fg of Xf-genomic DNA) and specific to the Italian De Donno
and American mulberry strains of Xf. When our LAMP was utilized in a duplex manner by combining with
previously published universal primers and probe for detection of all Xf-subspecies and strains, the duplex LAMP
showed high versatility in the simultaneous detection and differentiation of the Italian De Donno and American
mulberry stains form other subspecies/strains. Furthermore, the Hg gene-specific LAMP primers and TaqMan
probe were exploited to develop a new approach; henceforth referred to as the Fluorescence of TaqMan Probe
upon Dequenching - Loop mediated Isothermal Amplification (FTP-LAMP). In the FTP-LAMP, the Xf-Hg specific
fluorophore-quenched probe was added to a standard LAMP reaction and fluoresces only when bound to its
target, allowing for a sequence-specific detection of the Xf-Italian De Donno and American mulberry strains in a
LAMP context. Our FTP-LAMP assay showed to be highly sensitive detecting down to 100 fg genomic DNA of Xf,
when tested on Xf-genomic DNA extracted from infected plants, DAS-ELISA-crude saps and insect vectors.
Furthermore, the assay showed high specificity (98.7% vs 89% for LAMP) when applied on DNA templates from
insect vectors. With the addition of an extra target sequence-specific probe acting as a direct Xf-specific dye, the
FTP-LAMP has gained more specificity and reduced one of the main problems of the LAMP assay (false positives)
when used for detecting of Xf in insect vectors. To the best of our knowledge, this study reports the development
of the first LAMP assay and the first novel FTP-LAMP method for specific detection of the Italian De Donno and
the American mulberry strains of Xf. Together with the Xf universal LAMP primers in a duplex approach, the
FTP-LAMP could represent a useful tool not only for the specific detection of the olive-associated strain in Italy,
but also to differentiate the De Donno strain from other strains of Xf already reported in Italy and Europe
(Germany, France, Spain and Portugal).
1. Introduction
Xylella fastidiosa (Xf) inhabits plant xylem tissue and causes important diseases in over 30 plant families (Denancé et al., 2019; Guan
et al., 2015). Xf is transmitted by xylem-feeding insects, such as
sharpshooter leafhoppers (family Cicadellidae) and spittlebugs (family
Aphrophoridae) (Redak et al., 2014). In Europe, Xf was reported for the
first time in 2013 in Italy, when it was identified in the Apulian olive
⁎
trees affected by a disease named ‘Olive Quick Decline Syndrome
(OQDS)’, causing leaf scorch, extensive dieback and finally the death of
the entire plant (Martelli et al., 2016). In 2014, the sequence type 53
(ST53) was assigned to the Italian olive-associated strain of Xf (Elbeaino
et al., 2014b) (named CoDiRO - from the Italian ‘Complesso del Disseccamento Rapido dell'Olivo’- or De Donno strain) and in 2015 the
complete genome sequence was determined (Giampetruzzi et al.,
2015). Three insects [the meadow spittlebug Philaenus spumarius L. (Ps),
Corresponding author.
E-mail address: [email protected] (T. Elbeaino).
https://doi.org/10.1016/j.mimet.2020.105992
Received 19 May 2020; Received in revised form 22 June 2020; Accepted 22 June 2020
Available online 23 June 2020
0167-7012/ © 2020 Elsevier B.V. All rights reserved.
Journal of Microbiological Methods 175 (2020) 105992
T. Elbeaino, et al.
detection of the target strains of Xf by LAMP and real-time PCR assays,
respectively. In addition, the Italian De Donno- and American mulberry
strain-specific primers and probe were used together with those in
standard protocols reported for Xf detection at the species level (Francis
et al., 2006; Harper et al., 2010 erratum 2013) as a duplex LAMP assay,
for simultaneous detection and differentiation of the Italian De Donno
and American mulberry strains from other subsp./strains of Xf in infected plant materials and insect vectors. Furthermore, we report the
development and validation of a new real-time detection method
combining all the six LAMP primers with the TaqMan probe, which not
only offers the possibility to clearly differentiate the De Donno from
other subsp./strains, but also allows for the first time the use of multiple
sets of primers and probe in a LAMP approach, to detect possible
multiple Xf strain-infections in both plants and insect vectors. This
technique has been named as Fluorescence of TaqMan Probe Upon
Dequenching - Loop mediated Isothermal Amplification (FTP-LAMP).
The detection methods developed in this study were compared with the
methods reported in the literature for the detection of Xf (PCR, realtime PCR and LAMP) using Xf DNAs extracted from different infected
plant species and insect vectors, and their results are hereafter reported
and discussed.
P. italosignus Drosopolous & Remane (Pi) and Neophilaenus campestris
(Fallen) (Nc)] have been reported to be vectors of the De Donno strain
of Xf (Bucci, 2018; Cavalieri et al., 2019; Elbeaino et al., 2014a).
Based on a DNA-DNA hybridization (DDH) relatedness assay and
the sequencing of 16Se23S rRNA intergenic transcribed spacers (ITS),
three subspecies (subsp.) of Xf are taxonomically and officially recognized, i.e. Xf subsp. fastidiosa; Xf subsp. multiplex and Xf subsp.
pauca (Schaad et al., 2004). However, it should be noted that for the
subsp. pauca, the strain that is claimed to be representative of the
taxon, namely ICMP 15198, has not been deposited in two publicly
accessible services collections in two countries (Bull et al., 2012) as
required by the rule of the ‘International Code of Nomenclature of Bacteria’ (Lapage et al., 1992). Subsequently, based on multilocus sequence
typing (MLST) analyses of seven housekeeping genes, two additional,
i.e., Xf. subsp. sandyi isolated from oleander (Nerium oleander) and Xf.
subsp. morus, isolated from mulberry (Morus alba), have also been
proposed but not formally recognized (Scally et al., 2005; Nunney et al.,
2014).
The subsp. fastidiosa is present throughout large portions of the
United States (Central and North America) infecting mainly grapevines,
whereas the subsp. multiplex, first found in North America, has recently
been recorded in Europe (France, Spain, and Italy [Tuscany]) where 41
host plant species have been found to be susceptible (Marchi et al.,
2018). The subsp. sandyi mainly present in the southern regions of USA
and recently reported from Europe (Spain), affects oleanders. The
subsp. pauca generally found in central America infects citrus and
coffee (Marcelletti and Scortichini, 2016), and the subsp. morus in
Northern America causes leaf scorch in mulberry (Nunney et al., 2014).
In the Apulian region of Italy, several diagnostic protocols were
tested for the Xf-De Donno strain (subsp. pauca), including ELISA
(Loconsole et al., 2014), PCR (Guan et al., 2015; Minsavage et al.,
1994), direct tissue blot immunoassay (Djelouah et al., 2014), real-time
PCR (Francis et al., 2006) or Loop-mediated isothermal amplification
(LAMP) (Harper et al., 2010, erratum 2013; Yaseen et al., 2015). These
techniques compete together in the detection of Xf in both plants and
insect vectors. So far, although primers are available for molecular
detection of Xf at the species level, methodology for specific identification of a particular group of Xf strains by PCR has only been developed for citrus variegated chlorosis strains (Pooler and Hartung, 1995),
for oleander-infecting strains (Huang, 2009) and for the American
mulberry-infecting and Italian olive-associated strains (Guan et al.,
2015). Recently, several real-time PCR assays have been developed for
differentiating Xf subsp. fastidiosa, multiplex, pauca, and sandyi
(Burbank and Ortega, 2018; Dupas et al., 2019).
In Europe, standards for diagnostic protocols for Xf were recently
revised and a flow diagram for the diagnostic procedure for Xf in plant
material was described (European and Mediterranean Plant Protection
Organization, EPPO, 2019). Although molecular techniques remain
undoubtedly the most widely used due to their high throughput potential for detecting Xf-genomic DNA, their preferential use is conditioned by (i) the threshold level of detection limit of each technique; (ii)
minimum concentration of bacterial DNA needed; (iii) heavy reliance
on direct and specific detection, avoiding when possible the use of nonspecific dyes, (iv) presence of microbiome-genomic DNA similar to that
of Xf; (v) differential detection for subsp. and strains; (vi) flexible application on site (lab, field, inspection points), (vii) user-friendliness,
(viii) and costs. Among all molecular techniques, the use of LAMP is
growing increasingly showing potential applications in the diagnosis of
plant pathogens, thanks to its low cost, speed, sensitivity and flexibility
of use in various environments. Its highly sensitive feature exposes this
technique to high risks of contamination, especially when applied in the
field, and to non-specific reactions due to its strong dependence on an
indirect detection approach using non-pathogen-specific dyes.
In this paper, we report the design and validation of a set of six
primers and one TaqMan probe, based on a sequence unique to the
Italian De Donno and the American mulberry strains of Xf for specific
2. Materials and methods
2.1. Sampling of plant material and capture of insect vectors
A total of 36 leaf samples were collected from different plant species
including almond (4 trees), olive (18 trees), oleander (6 plants), pelargonium (2 plants) and rosemary (6 plants), all showing symptoms of
leaf scorch. The 36 trees were growing in four different orchards in the
Xf-affected area of Gallipoli (Lecce province, south of Italy), where a
search for insect vectors of Xf, including Philaenus spumarius (Ps), P.
italosignus (Pi) and Neophilaenus campestris (Nc) was also conducted.
Insects were manually trapped using a sweeping net passed over the
foliage of olive trees and on vegetations in Xf-infected orchards, individually stored in a 95% of ethanol solution before transporting to the
laboratory for species identification, as described in Elbeaino et al.
(2014a).
2.2. Extraction of bacterial DNA from pure culture, plants and insect
vectors
Genomic DNA of Xf was extracted from the pure culture of Xf-De
Donno strain (Elbeaino et al., 2014b), tissues of leaf petioles and midveins excised from scorched leaves and from insect vectors, using a
CTABs protocol (2% Hexadecyl trimethyl-ammonium bromide, 0.1 M
Tris-HCl pH 8, 20 mM EDTA and 1.4 M NaCl) (Hendson et al., 2001).
For Xf pure cultures, ten Xf-colonies were scrapped from the surface of a
BYCE solid medium and bacterial genomic DNA was extracted using
DNeasy Blood and Tissue Kit (Qiagen, Milan, Italy) following the
manufacturers' instructions.
From leaf tissue, 0.3 g of fresh small pieces of midribs and petioles
were homogenized with 2 ml of CTAB using an automated hammer. The
plant extract was incubated at 65 °C for 30 min before getting treated
with chloroform. Total nucleic acids (TNA) were then precipitated with
0.6 volume of cold 2-propanol and resuspended in sterile water. For
adult insect vectors, individual insects were washed with deionized
water to remove ethanol residue, and then the head of each insect was
ground with 500 μl of CTAB. TNAs were precipitated and resuspended
in sterile water as described for plant material. DNA concentrations of
all samples were quantified using a NanoDrop spectrophotometer (Life
Technologies).
2.3. DAS-ELISA and PCR
DAS-ELISA was applied on the 36 leaf samples from different plant
2
Journal of Microbiological Methods 175 (2020) 105992
T. Elbeaino, et al.
The duplex TaqMan real-time PCR assay was performed in one reaction using primers and probes designed in this study, together with
those of Harper et al., (2010, erratum 2013), using the same concentrations for each primer and probe and under the same cycling
condition as described above for the singleplex TaqMan real-time PCR.
The interpretation of the results at both the Xf species and target strain
levels was made easy because the TaqMan probes were labelled with
different fluorophores that resulted in different colored display.
The specificity of the primers and the probe we designed was assessed by both singleplex and duplex TaqMan real-time PCR using
template DNAs extracted from pure cultures of seventeen Xf strains
belonging to different subsp., including Xf-De Donno, three mulberryinfecting strains and thirteen strains isolated from sycamore, oak, elm,
maple, plum, grape, and oleander (Table 2) (Guan et al., 2015).
The three primer pairs designed based on the Hg gene were tested by
LAMP for the detection of the Xf-Italian De Donno strain. Reactions
were performed in a 25 μl of final volume containing 15 μl of dye based
ISO-001 Isothermal Mastermix (Optigene, Horsham, United Kingdom),
0.12 μM of Hg-F3/Hg-B3 outer primers, 0.4 μM of Hg-LF/Hg-LB loop
primers, 0.5 μM of Hg-FIP/Hg-BIP inner primers, and 3 μl of DNA
sample. The specificity of the LAMP primers was determined using
DNAs from the same 17 Xf strains described above (Table 2). The LAMP
assay was conducted in a CFX96 thermocycler (BioRad, Milan, Italy) at
60 °C for 30 mins and quantification was performed by interpolation in
a standard regression curve of Ct values generated from DNA samples of
known concentrations.
species using an antibody specific to Xf (Agritest srl, Valenzano, Italy),
according to the manufacturers' instructions. Protein extracts were
obtained from petiole and midvein tissues crushed with an automated
hammer in the presence of phosphate-saline buffer. Absorbance at
405 nm was measured using an automatic microplate reader (Multiskan
Ascent, Labsystems). Samples with absorbance readings exceeding
three times that of the healthy control were considered positive.
The presence of Xf in different plant hosts and insect vectors was
also investigated by PCR using primers RST31/33 (Minsavage et al.,
1994). PCR reactions were conducted in a final volume of 25 μl containing 1× amplification buffer, 2.5 μl of TNA, 0.2 mM of dNTPs,
0.2 μM of each primer and 1.25 U of DreamTaq™ DNA polymerase (Life
Technologies, Monza, Italy). PCR cycles and conditions were the same
as described by Minsavage et al. (1994). PCR amplicons were electrophoresed in 1.2% TAE agarose gel.
2.4. Design of a TaqMan probe and LAMP primers specific to a predicted
Hemagglutinin-related protein gene (Hg) of Xf
A unique gene annotated to code for a Hemagglutinin-related protein was previously found to be present only in the American mulberry
strains Mul-MD and MUL0034 (accession number CP006740/
locus_tag = “P303_12010”) and the Italian De Donno strain (accession
number: CP020870/locus_tag = “B9J09_03940”), sharing 98.4% of
nucleotide identity, but not in any other Xf strains (Guan et al., 2015).
This gene was therefore used to design one TaqMan probe (Hg-PbF) and
six LAMP primers for the specific detection of the American mulberry
and Italian De Donno strains. Three sets of primers, namely outer, inner
and loop primers for a LAMP assay were designed using the LAMP
Designer software Optigene (Horsham, UK) (Table 1).
2.6. Development of fluorescence of TaqMan probe upon dequenchingLAMP assay (FTP-LAMP)
We developed the first innovative method for detection of Xf, using
the reciprocal principles of the TaqMan real-time PCR and LAMP. This
method uses a fluorophore-labelled probe (positioned between the two
inner primers) added to the LAMP reaction mixture, which fluoresces
only when it is hydrolyzed by its target (amplicon). The method is
therefore called Fluorescence of TaqMan Probe Upon Dequenching LAMP (FTP-LAMP). The new FTP-LAMP technique developed in this
study was based on the concept of the Fluorescence of Loop Primer
Upon Self Dequenching-LAMP (FLOS-LAMP) (Gadkar et al., 2018),
where a labelled loop quenches in its unbound state, and fluoresces only
when bound to its target.
The specificity of the FTP-LAMP to detect the Italian De Donno,
together with the American mulberry strains of Xf, was assessed by
testing DNA templates extracted from the 36 collected plant accessions,
and 125 specimens of each insect species (Ps and Nc), as well as
genomic DNAs from the 17 Xf strains listed in Table 2. The plant and
insect DNAs tested by the FTP-LAMP samples were also tested by a
LAMP assay (Harper et al., 2010, erratum 2013) for comparison to
determine the specificity of the FTP-LAMP.
The efficiency and versatility of the FTP-LAMP to detect Xf was also
2.5. Development of singleplex and duplex TaqMan real-time PCR and
LAMP
In order to specifically detect the American mulberry and Italian De
Donno strains of Xf. using a TaqMan real-time PCR in a sinleplex reaction., the outer primer set (Hg-F3/Hg-B3) was used together with the
probe Hg-PbF labelled with the “Cy5” fluorophore at the 5′-end and
“BHQ-2” at the 3′-end. The primers and probe set were also duplexed
with previous published primers and probe set XF-F/XF-R/XF-P (Harper
et al., 2010, erratum 2013) for simultaneous detection and differentiation of Xf subsp./strains.
The singleplex TaqMan real-time PCR assay was performed in a
20 μl reaction volume containing 10 μl of the SsoAdvanced ™ Universal
Probes Supermix (BioRad, Milan, Italy), 0.3 μM HgeF3 (forward) and
HgeB3 (reverse) primers, 0.125 μM of Hg-PbF probe and 3 μl (50 ng) of
TNA. Thermocycling conditions were 94 °C for 5 min, followed by
40 cycles of 94 °C for 10 s and 58 °C for 40 s in a CFX96 thermocycler
(BioRad, Milan, Italy). A cycle threshold (Ct) value below 35 was scored
as a positive result.
Table 1
List of primers and probe designed in this study based on a unique Haemagglutinin-related protein gene (Hg) sequence of Xf for specific detection of the Italian De
Donno and American mulberry strains of X. fastidiosa by TaqMan real-time PCR, LAMP and FTP-LAMP assays.
Primers probe
LAMP
Hg-F3⁎
Hg-B3⁎
Hg-FIP
Hg-BIP
Hg-LF
Hg-LB
TaqMan real-time PCR
Hg-PbF
⁎
Categories
Sequence (5′-3′)
Binding sites on De Donno Hg gene
Outer
GAGTTGATTATTCTGKGTTCTCT
ATTCTTGTGTACTCCGCCTCAT
AGAGCCAAACTTTTCGCACTAGAAGAGCTTGGAGCCAAGTT
ATTGGTAGGAAAGAYGGTTACTCCTCAACTAAAAAGCGAATTTG
TCAATCATCCAGTCGGAATAC
ATATGGTGACCCTAGTGTGGA
62–84
338–359
87–107\140–159
190–210\283–305
114–134
258–278
CY5-AGTGACAGTAGTAATTAGACACCCT-BHQ2
162–186
Inner
Loop
TaqMan probe
Primers used also in the TaqMan real-time PCR.
3
Journal of Microbiological Methods 175 (2020) 105992
T. Elbeaino, et al.
Table 2
List of X. fastidiosa strains used in this study to assess the specificity and sensitivity of the newly developed TaqMan real-time PCR, LAMP and FTP-LAMP assays.
Strain
Sequence type
Host
Subspecies/strain
Origin
Reference
Mul-MD
Mul-ATCC35869
Mul-7
Sy-VA
Oak 88–9
Elm
GA plum 2#4
Maple-UCB
PCE-FG
PD 95–8
Fetzer
UCLA
SB
LTS
PS
TR2
Xf-De Donno
29
29
Mulberry
Mulberry
8
Sycamore
Oak
Elm
Plum
Maple
Grape
Multiplex
Maryland
Washington, DC
Nebraska
Virginia
Florida
Washington, DC
Georgia
California
Florida
Florida
California
California
Texas
Texas
Texas
California
Apulia
Guan et al., 2014
American Type Culture Collection
Guan et al., 2015
Huang, 2009
Guan et al., 2015
Guan et al., 2015
Guan et al., 2015
Guan et al., 2015
Guan et al., 2015
Guan et al., 2015
Huang, 2009
Guan et al., 2015
Huang, 2009
Huang, 2009
Huang, 2009
Huang, 2009
Elbeaino et al., 2014b
41
7
53
Fastidiosa
Oleander
Sandyi
Olive
Pauca
From the insects we collected, 233 adult specimens of Ps and 141 of
Nc were identified, but Pi was not found. The high number of Ps captured in the field was not surprising because this species is more dynamic than Nc in the Apulian environment, confirming previous reports
(Ben Moussa et al., 2016; Cavalieri et al., 2019). PCR assays applied on
125 specimens randomly chosen from each species showed that 24
specimens of Ps and 4 of Nc were carrying Xf. Similarly, all PCR-positive
and -negative insect DNA samples were used to test the efficiency and
specificity of the newly developed techniques, i.e. TaqMan real-time
PCR, LAMP and FTP-LAMP.
explored using the DAS-ELISA-crude saps of plant accessions. In this
case, crude sap (10 μl) was used for incubation with 200 μl of extraction
buffer (1× sodium chloride-Tris-EDTA and 0.5% Triton-X100) for
10 min at 70 °C. Three μl of this denatured extract were used in the FTPLAMP reactions. The FTP-LAMP reactions were performed in a final
volume of 25 μl, containing 15 μl of no dye ISO-001 Isothermal
MasterMix (Optigene, Horsham, United Kingdom), 0.12 μM of Hg-F3/
Hg-B3 outer primers, 0.4 μM of Hg-LF/Hg-LB loop primers, 0.5 μM of
Hg-FIP/Hg-BIP inner primers, 0.2 μM of HgeP probe and 3 μl of DNA
sample.
We also developed a duplex approach in FTP-LAMP, by adding the
six LAMP primers described by Harper et al. (2010, erratum 2013) to
our Hg gene-based primers and probe set in the FTP-LAMP for a simultaneous detection of different strain/s and/or subsp. in the same
reaction. The duplex FTP-LAMP reactions were performed in a final
volume of 25 μl, containing 15 μl of dye based ISO-001 Isothermal
MasterMix (Optigene), 0.12 μM of Hg-F3/Hg-B3 outer primers, 0.4 μM
of Hg-LF/Hg-LB loop primers, 0.5 μM of Hg-FIP/Hg-BIP inner primers,
0.2 μM of HgeP probe, as well as 0.12 μM of XF-F3/XF-B3 outer primers, 0.2 μM of XF-LF/XF-LB loop primers, 0.16 μM of XF-FIP/XF-BIP
inner primers, and 3 μl of DNA sample. Both FTP-LAMP and duplexed
FTP-LAMP were conducted in a CFX96 thermocycler (BioRad) at 60 °C
for 30 mins.
3.2. TaqMan real-time PCR and LAMP for specific detection of Xf-De
Donno strain
Both of our TaqMan real-time PCR and LAMP assays targeting the
unique gene sequences of the Xf-De Donno strain, detected Xf in the 26
plant accessions and 28 insect vectors (24 Ps and 4 Nc) that were tested
positive for Xf by DAS-ELISA and PCR assays, respectively. No additional infected plant accessions and insect vectors were tested positive
for Xf by either assay (Fig. 1).
When the sensitivity of our TaqMan real-time PCR was compared to
that of Harper et al. (2010, erratum 2013) using ten-fold serial dilutions
starting from 10 ng of Xf-genomic DNA extracted from the pure culture
of De Donno strain, both assays showed the same detection limit of
100 fg (Fig. 2).
2.7. Sensitivity evaluation of our TaqMan real-time PCR, LAMP and FTPLAMP for detection of Xf- Italian De Donno strain
To determine the detection limit of all the methods developed in
this study, 10-fold serial dilutions of 10 ng/μl of DNA extracted from a
pure culture of Xf-De Donno strain and crude sap of healthy plants, to
which these DNA dilutions were added and tested under the conditions
and cycles described above for each method. Three replications for each
dilution were used for each assay.
3.3. Singleplex and duplex TaqMan real-time PCR
The specificity of our TaqMan real-time PCR for detection of the
Italian De Donno (ST53) and American mulberry strains (ST29) was
determined by using genomic DNAs from 17 different subsp. and strains
of Xf (Table 2). The amplification curves obtained from the TaqMan
real-time PCR clearly demonstrated that the unique Hg gene-dependent
primers and probe were able to detect the Italian De Donno and the
three mulberry-infecting strains, but not any other subsp. and strains of
Xf (Fig. 3).
When the same DNA samples were tested by our duplex TaqMan
real-time PCR, DNAs of the Italian De Donno and American mulberry
strains resulted in two different colorimetric curves as a result of the
fluorescence emission by the Cy5 in the Xf-De Donno-specific probe
(Table 1) and the FAM-F3 probe for the universal detection of subsp.
and strains of Xf (Harper et al., 2010, erratum 2013), detecting and
distinguishing the Italian De Donno and American mulberry strains
from the remaining Xf strains in a single reaction (Fig. 3). Samples from
other Xf-subsp. strains showed only single curves (Fig. 3).
3. Results
3.1. Presence of X. fastidiosa in different plant species, and two insect
vectors Philaenus spumarius and Neophilaenus campestris
Results of the DAS-ELISA and PCR, both performed on 36 samples
from different plant species, were identical and showed that 26 accessions were infected with Xf, including 3 of 4 tested almonds, 17 of 18
olives, 3 of 6 oleander, 1 of 2 pelargonium and 2 of 6 rosemary. As a
result, these DNA samples were used to test the efficiency and specificity of the different diagnostic methods we developed using their respective primers and probe for detection of Xf.
4
Journal of Microbiological Methods 175 (2020) 105992
T. Elbeaino, et al.
Fig. 1. TaqMan real-time PCR (a, b) and LAMP (c, d) assays showing amplification curves obtained from Xf-infected plant samples (a, c) and insect vectors (b, d),
with primers and probe specific to the Hg gene sequence of the De Donno strain. Positive reactions are curves with Ct values between cycles 20 and 35. Xf-free
samples generated flat curves.
generated from the FTP-LAMP assay, when performed on the Xf-free Ps
(101 specimen) and Xf-free Nc (120 specimens), contrary to what frequently occurred when the LAMP (Harper et al., 2010, erratum 2013) is
applied on insects. When the FTP-LAMP was compared with the LAMP,
we found that the latter generated false positive reactions (Ct values > 35) from 11 Xf-free Ps specimen (ca. 11%), and from 13 Xf-free
Nc specimen (ca. 13%). The false positive status of the 24 LAMP positive insect samples was confirmed by both the TaqMan real-time PCR
and FTP-LAMP. In our experiment, only 3 samples (out of 221 specimen
3.4. Development and validation of the FTP-LAMP
The FTP-LAMP assay we developed, detected Xf in infected plant
accessions and insect vectors with Ct values of positive reactions ranging between cycles 24th and 35th, confirming the results obtained by
DAS-ELISA (for plant samples), PCR, TaqMan real-time PCR and LAMP
(for insect vectors) and demonstrating the efficiency of the FTP-LAMP
as a novel approach for detecting Xf (Fig. 4).
It was worth mentioning that non-specific curves were not
Fig. 2. Comparative sensitivity analysis of two TaqMan real-time PCR assays by (a) Harper et al., 2010 and (b) developed in this study, showing sequential
amplification curves obtained from 10-fold serial dilutions of bacterial DNA extracted from the pure culture the Xf De Donno strain. Both assays showed the same
detection limit of 100 fg/μl of Xf-genomic DNA under our assay conditions.
5
Journal of Microbiological Methods 175 (2020) 105992
T. Elbeaino, et al.
Fig. 3. Specificity of the singleplex and duplex TaqMan real-Time PCR for detection of different Xf subspecies and strains listed in Table 2. (a) The singleplex assay
detected only the Xf-De Donno and the American mulberry-infecting strains (+CoDiRO (De Donno), Mul-7, Mul-ATCC35869 and Mul-MD), but not the other
subspecies and strains. (b) The duplex TaqMan real-time PCR showed two colored curves as results of the fluorescence emission of the Cy5-Xf De Donno-specific
probe (violet curves) and the FAM-F3-universal probe (blue curves). The other X. fastidiosa strains were recognized only by the universal probe (blue curves). (For
interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
and De Donno-specific probes (Fig. 5).
Xf-free -Ps and -Nc tested) had generated non-specific curves (Ct
value > 35) in FTP-LAMP (ca. 1.3% of non-specificity), most likely due
to a contamination while samples manipulation, since when retested by
PCR, TaqMan real-time PCR and LAMP, none of them were resulted
positive. Furthermore, the FTP-LAMP showed to be a highly versatile
and specific technique for detecting Xf in DAS-ELISA-crude saps after a
quick extraction of different plant accessions without affecting its specificity in detecting Xf in those samples (Fig. 4).
3.6. Specificity and detection limit of the duplex FTP-LAMP
The specificity of the duplex FTP-LAMP was assessed by using
genomic DNA from 17 different Xf subsp. and strains listed in Table 2.
Only the Xf-De Donno and the three American mulberry-infecting
strains generated two amplification curves; contrarily to the other 13 Xf
subsp.\strains that were exclusively amplified by the primers set of
Harper et al. (2010, erratum 2013) (Fig. 6a).
The duplex FTP-LAMP showed high level of sensitivity by amplifying all dilutions down to 100 fg/μl (Fig. 6b), similarly to the detection
limit reported for the LAMP used for detecting De Donno in Italy
(Yaseen et al., 2015). The duplex LAMP also demonstrated to be sensitive by detecting Xf in all De Donno-containing plants, insects-vectors
and DAS-ELISA-crude saps.
3.5. Duplex FTP-LAMP
A duplex detection approach, combining in one reaction the Hg
gene-based primers and probe of the FTP-LAMP and the six LAMP
primers developed by Harper et al. (2010, erratum 2013), was explored
to determine the potential use of the duplex FTP-LAMP in detecting
multiple Xf subsp. and target strains of Xf. The duplex FTP-LAMP was
tested using DNAs extracted from different plant accessions and insect
vectors, and from DAS-ELISA-crude saps after a quick extraction. Our
duplex FTP-LAMP not only detected Xf at the De Donno strain level
(Fig. 5) as our TaqMan real-time PCR (Fig. 4), but also at the species
level in De Donno strain-infected plant and insect samples, by displaying double amplification curves between the 20th and the 35th
cycles, following the emission of the two fluorophores in the universal
4. Discussion
Detection of Xf in infected plant material is achieved by numerous
diagnostic methods including protein-based serological (ELISA) and
DNA-based molecular techniques such as PCR, real-time PCR and
LAMP. When looking for versatility, precision and sensitivity, however,
Fig. 4. Real-time amplification of the target Xf strain by FTP-LAMP in different Xf-infected plant hosts (almond, olive, oleander, pelargonium and rosemary) and Xfcarrying insect vectors (Philaenus spumarius and Neophilaenus campestris) (a), and using DAS-ELISA-crude saps from infected plant samples as DNA templates (b). Xffree plants and insect vectors generated flat curves in both assays.
6
Journal of Microbiological Methods 175 (2020) 105992
T. Elbeaino, et al.
Fig. 5. Amplification of Xf by the duplex FTP-LAMP assay showing double amplification curves (violet: Cy5-Hg-PbF Xf De Donno strain-specific probe, and blue:
FAM-XF-P- Xf universal probe) for each tested plant and insect vector carrying the Xf-De Donno strain, when (a) the DAS-ELISA-crude saps of 26 Xf-infected samples
and (b) DNA of 9 Xf-infected samples extracted using the CTAB method, were all used as DNA templates. (For interpretation of the references to colour in this figure
legend, the reader is referred to the web version of this article.)
design of specific primers and probe based on a Hg gene, a sequence
uniquely present in the Xf-De Donno (ST53, Italy) and the mulberryinfecting Xf-strains (ST29, USA), to be used in real-time detection assays (TaqMan real-time PCR and LAMP) for specific detection and
identification of the De Donno, and similarly the mulberry-infecting
strains (Guan et al., 2015) in plants and in typical territorial insects (Ps
and Nc) found to be vectors of Xf in Apulia region, Italy.
In this study, we also developed a new approach for Xf detection,
named FTP-LAMP, based on the concept of the FLOS-LAMP (Gadkar
et al., 2018), in which a labelled Loop primer, acting as a probe itself,
fluoresces only when bound to its target. In our FTP-LAMP, a labelled
TaqMan probe that specifically hybridizes to the Xf-Hg gene of the De
Donno strain, in a sequence dependent manner, was added to the 6
primers conventionally used in a LAMP, thereby adding more specificity to the reaction. This approach was undertaken due to the fact that
even though LAMP relies on 4–6 different primers to independently
recognize 6–8 independent regions of the target sequence, suggesting,
at least in theory, a higher degree of specificity than a two-primer PCR;
one of the major disadvantages of LAMP remains to be its heavy reliance on indirect detection methods such as turbidity and non-specific
dyes, which often leads to false positives.
All the techniques developed here, based on the exclusive presence
of the Hg gene in the Xf-De Donno and American mulberry strains,
preferential differences emerge for each of them, thereby influencing
their application. For instance, serological tests are widely adopted to
detect Xf in plant material, but completely inapplicable to insect vectors
due to the low concentration of the bacterium in the insects. Low
numbers of Xf in insect vectors also means that limited amount of Xf
DNA can be extracted from a single specimen, making it difficult to
detect Xf in insect vectors by PCR amplification of some genes
(housekeeping genes) typically used for the detection and characterization of the subsp. and strains of Xf. When dealing with detection of Xf
in insects, there is generally little experience on the best diagnostic
method to adopt, and when present it is influenced by (i) the process
and quality of the DNA extracted from the plant or insect tissue, (ii) the
lack of a customized protocol to all insect species and (iii) the subsp.
\strains type of Xf. In front of the Xf emergency in Europe, the EPPO has
regulated the diagnosis of the bacterium in insects through referenced
DNA-based protocols, i.e. PCR, real-time PCR and LAMP (EPPO, 2019).
However, the specificity and versatility of these assays when strictly
applied on insect vectors, in the European scenario, have not been fully
studied. As a result, the European researchers had launched different
proposals for comparative detection analyses among different diagnostic techniques to determine the versatility of these assays on the
detection of Xf in the European insect species.
In anticipation of the research need, we report in this study the
Fig. 6. (a) Specificity of the Multiplex FTP-LAMP. When the 17 different strains of Xf listed in Table 2 were tested by the multiplex FTP-LAMP, only genomic DNAs
from the De Donno- and the American mulberry-infecting strains (indicated by arrows) displayed double amplification curves; whereas the other strains showed only
one curve. (b) Sensitivity of the duplex FTP-LAMP showing real-time amplification curves of different genomic DNA concentrations of Xf strain De Donno with the
detection limit determined to be 100 fg/μl of Xf-genomic DNA.
7
Journal of Microbiological Methods 175 (2020) 105992
T. Elbeaino, et al.
proved to be highly sensitive in detecting both strains in infected plants
and insects, with detection limits equal or slightly less than those reported in referenced protocols on purified DNA, i.e. 10 to 100 fg/μl of
bacterial genomic DNA (Aglietti et al., 2019; Harper et al., 2010, erratum 2013; Yaseen et al., 2015). However, the main advantages of the
techniques we developed reside on their specificity and versatility to
detect single and multiple infections in one reaction. Without appropriate techniques, it is difficult to determine whether more than one
strain or subsp. of Xf can exist in a single plant, and whether insectvectors can carry more than one strain(s)/subsp. (Costa et al., 2004;
Chen et al., 2005). The duplex approach could, therefore, represent a
useful tool in the European scenario, allowing not only specific detection of the olive-associated strains in Italy, but also differentiation of
the De Donno strain from other strains of Xf already reported in Italy
and Europe (Germany, France, Spain and Portugal). This high potentiality of detection was extended to the DNA from ELISA-crude sap
extract, adding an extra advantage to FTP-LAMP, if used for Xf detection in a large scale. It is worth mentioning that the FTP-LAMP was
more precise (98.7% of specificity) than the LAMP reported in the literature (89 in detecting Xf in insect vectors. The problem of the LAMP
assay to produce non-specific reactions (false positives) at a Ct > 35th
cycle is notoriously known by diagnosticians, and recurrent when detecting Xf in insect vectors. These reactions are a dilemma for the interpretation of the results, as far as for considering the insect is infected
or with low Xf-DNA concentration, thus the accuracy of the FTP-LAMP
in this regard has made a big difference in offering a highly precise
diagnostic tool. To the best of our knowledge, previous LAMP and Realtime PCR assays have not been developed for specific detection of the
Italian De Donno- and the American mulberry-infecting strains, so the
FTP-LAMP we developed in this study would allow for specific detection and differentiation of the target strains from other subsp./strains of
Xf in both Italy and the USA.
Cooksey, D.A., 2004. Plant hosts of Xylella fastidiosa in and near southern California
vineyards. Plant Dis. 88, 1255–1261.
Denancé, N., Briand, M., Gaborieau, R., Gaillard, S., Jacques, M.A., 2019. Identification of
genetic relationships and subspecies signatures in Xylella fastidiosa. BMC Genomics
20, 239.
Djelouah, K., Frasheri, D., Valentini, F., D’Onghia, A.M., Digiaro, M., 2014. Direct tissue
blot immunoassay for detection of Xylella fastidiosa in olive trees. Phytopathol. Medit.
53, 559–564.
Dupas, E., Briand, M., Jacques, M.-A., Cesbron, S., 2019. Novel Tetraplex quantitative
PCR assays for simultaneous detection and identification of Xylella fastidiosa subspecies in plant tissues. Front. Plant Sci. 10, 1732.
Elbeaino, T., Valentini, F., Abou Kubaa, R., Moubarak, P., Yaseen, T., Digiaro, M., 2014a.
Multilocus sequence typing of Xylella fastidiosa isolated from olive affected by “olive
quick decline syndrome” in Italy. Phytopathol. Medit. 53, 533–542.
Elbeaino, T., Yaseen, T., Valentini, F., Ben Moussa, I.E., Mazzoni, V., D’Onghia, A.M.,
2014b. Identification of three potential insect vectors of Xylella fastidiosa in southern
Italy. Phytopathol. Medit. 53 (2), 328–332.
EPPO Bulletin, 2019. PM 7/24 (4) Xylella fastidiosa. 49 (2), 175–227.
Francis, M., Lin, H., Rosa, J.C.-L., Doddapaneni, H., Civerolo, E.L., 2006. Genome-based
PCR primers for specific and sensitive detection and quantification of Xylella fastidiosa. Eur. J. Plant Pathol. 115, 203–213.
Gadkar, V.J., Goldfarb, D.M., Gantt, S., Tilley, P.A., 2018. Real-time detection and
monitoring of loop mediated amplification (LAMP) reaction using self-quenching and
dequenching fluorogenic probes. Sci. Rep. 8, 5548.
Giampetruzzi, A., Chiumenti, M., Saponari, M., Donvito, G., Italiano, A., Loconsole, G.,
Boscia, D., Cariddi, C., Martelli, G.P., Saldarelli, P., 2015. Draft genome sequence of
the Xylella fastidiosa CoDiRO strain. Genome Announc. 3 (1). https://doi.org/10.
1128/genomeA.01538-14. e01538–14.
Guan, W., Shao, J., Zhao, T., Huang, Q., 2014. Genome sequence of a Xylella fastidiosa
strain causing mulberry leaf scorch disease in Maryland. Genome Announc. 2 (2).
https://doi.org/10.1128/genomeA.00916-13. e00916-13.
Guan, W., Shao, J., Elbeaino, T., Davis, R.E., Zhao, T.C., Huang, Q., 2015. Specific detection and identification of American mulberry-infecting and Italian olive-associated
strains of by polymerase chain reaction. PLoS One 10, e0129330. https://doi.org/10.
1371/journal.pone.0129330.
Harper, S., Ward, L., Clover, G., 2010. Development of LAMP and real-time PCR methods
for the rapid detection of Xylella fastidiosa for quarantine and field applications.
Phytopathology 100 (12), 1282–1288.
Hendson, M., Purcell, A.H., Chen, D., Smart, C., Guilhabert, M., Kirkpatrick, B., 2001.
Genetic diversity of Pierce’s disease strain and other pathotypes of Xylella fastidiosa.
Appl. Environ. Microbiol. 67, 895–903.
Huang, Q., 2009. Specific detection and identification of Xylella fastidiosa strains causing
oleander leaf scorch using polymerase chain reaction. Curr. Microbiol. 58, 393–398.
Lapage, S.P., Sneath, P.H.A., Lessel, E.F., Skerman, V.B.D., Seeliger, H.P.R., Clark, V.A.,
1992. International Code of Nomenclature of Bacteria 1990. Revision Bacteriological
Code. American Society for Microbiology, Washington.
Loconsole, G., Potere, O., Boscia, D., Altamura, G., Djelouah, K., Elbeaino, T., Frasheri, D.,
Lorusso, D., Palmisano, F., Pollastro, P., 2014. Detection of Xylella fastidiosa in olive
trees by molecular and serological methods. J. Plant Pathol. 96 (1), 7–14.
Marcelletti, S., Scortichini, M., 2016. Xylella fastidiosa CoDiRO strain associated with the
olive quick decline syndrome in southern Italy belongs to a clonal complex of the
subspecies pauca that evolved in Central America. J. Microbiol. 162 (12), 2087–2098.
Marchi, G., Rizzo, D., Ranaldi, F., Ghelardini, L., Ricciolini, M., Scarpelli, I., Drosera, L.,
Goti, E., Capretti, P., Surico, G., 2018. First detection of Xylella fastidiosa subsp.
multiplex DNA in Tuscany (Italy). Phytopathol. Medit. 57, 363–364.
Martelli, G.P., Boscia, D., Porcelli, F., Saponari, M., 2016. The olive quick decline syndrome in south-east Italy: a threatening phytosanitary emergency. Eur. J. Plant
Pathol. 144, 235–243.
Minsavage, G.V., Thompson, C.M., Hopkins, D.L., Leite, M.V.B.C., Stall, R.E., 1994.
Development of a polymerase chain reaction protocol for detection of Xylella fastidiosa in plant tissue. Phytopathology 84, 456–461.
Nunney, L., Schuenzel, E.L., Scally, M., Bromley, R.E., Stouthamer, R., 2014. Large-scale
intersubspecific recombination in the plant-pathogenic bacterium Xylella fastidiosa is
associated with the host shift to mulberry. Appl. Environ. Microbiol. 80, 3025–3033.
Pooler, M.R., Hartung, J.S., 1995. Specific PCR detection and identification of Xylella
fastidiosa strains causing citrus variegated chlorosis. Curr. Microbiol. 31, 377–381.
Redak, R.A., Purcell, A.H., Lopes, J.R.S., Blua, M.J., Mizell, R.F., Andersen, P.C., 2014.
The biology of xylem fluid-feeding insect vectors of Xylella fastidiosa and their relation to disease epidemiology. Annu. Rev. Phytopathol. 49, 243–245.
Scally, M., Schuenzel, E.L., Stouthamer, R., Nunney, L., 2005. Multilocus sequence type
system for the plant pathogen Xylella fastidiosa and relative contribution of recombination and point mutation to clonal diversity. Appl. Environ. Microbiol. 71,
8491–8499.
Schaad, N.W., Postnikova, E., Lacy, G., Fatmi, M., Chang, C.J., 2004. Xylella fastidiosa
subspecies: X. fastidiosa subsp. piercei, subsp. nov., X. fastidiosa subsp. multiplex subsp.
nov., and X. fastidiosa subsp. pauca subsp. nov. Erratum in: System Appl Microbiol. 27.
pp. 763.
Yaseen, T., Drago, S., Valentini, F., Elbeaino, T., Stampone, G., Digiaro, M., D’Onghia,
A.M., 2015. On-site detection of Xylella fastidiosa in host plants and in “spy insects”
using the real-time loop-mediated isothermal amplification method. Phytopathol.
Medit. 54 (3), 488–496.
Declaration of Competing Interest
The authors declare no competing interests.
Acknowledgment
The authors thank Dr. Vincenzo Cavalieri (CNR of Bari, Italy) for
identifying the species of collected insects.
References
Aglietti, A., Luchi, N., Pepori, A.L., Bartolini, P., Pecori, F., Raio, A., Capretti, P., Santini,
A., 2019. Real-time loop-mediated isothermal amplification: an early-warning tool
for quarantine plant pathogen detection. AMB Express 9, 50.
Ben Moussa, I.E., Mazzoni, V., Valentini, F., Yaseen, T., Lorusso, D., Speranza, S., Digiaro,
M., Varvaro, L., Krugner, R., D’Onghia, A.M., 2016. Seasonal fluctuations of sapfeeding insect species infected by Xylella fastidiosa in Apulian olive groves of
southern Italy. J. Econ. Entomol. 109 (4), 1512–1518.
Bucci, E.M., 2018. Xylella fastidiosa, a new plant pathogen that threatens global farming:
ecology, molecular biology, search for remedies. Biochem. Biophys. Res. Commun.
502 (2), 173–182.
Bull, C.T., De Boer, S.H., Denny, T.P., Firrao, G., Fischer-Le Saux, M., Saddler, G.S.,
Scortichini, M., Stead, D.E., Takikawa, Y., 2012. List of new names of plant pathogenic bacteria (2008–2010). J. Plant Pathol. 94, 21–27.
Burbank, L.P., Ortega, B.C., 2018. Novel amplification targets for rapid detection and
differentiation of Xylella fastidiosa subspecies fastidiosa and multiplex in plant and
insect tissues. J. Microbiol. Methods 155, 8–18.
Cavalieri, V., Altamura, G., Fumarola, G., Di Carolo, M., Saponari, M., Cornara, D., Bosco,
D., Dongiovanni, C., 2019. Transmission of Xylella fastidiosa subspecies pauca sequence type 53 by different insect species. Insects 10, 324.
Chen, J., Groves, R., Civerolo, E.L., Viveros, M., Freeman, M., Zheng, Y., 2005. Two
Xylella fastidiosa genotypes associated with almond leaf scorch disease on the same
location in California. Phytopathology 95, 708–714.
Costa, H.S., Raetz, E., Pinckard, T.R., Gispert, C., Hernandez-Martinez, R., Dumenyo, C.K.,
8