ElemenT di geneTca: chi, come, perché

annuncio pubblicitario
Elemen0 di gene0ca: chi, come, perché Lino Ome<o Dipar0mento di Biodiversità e Ecologia Molecolare Centro Ricerca e Innovazione FEM Fenologia delle piante, aspe/ gene0ci e pianificazione Villa San(, Montagne (TN), 9/11/2012 DNA 1 COPERTA DI LANA ROSSA Proteina/e x1
“funzione” Mi riparo dal freddo Diversità e variabilità gene0ca Gene A Gene B Gene C Gene D Gene A Gene B Gene C Gene D Come si crea diversità gene0ca? •  Mutazioni •  Migrazione •  Ricombinazione 1 3 COPERTA COPRTA DI LANA DI RANA ROSSA GROSSA x1
x3
? TRE COPRTA DI RANA GROSSA x3
? ……. UNA COPERTA DI LANA ROSSA x1
……. TRE COPERTE DI LANA GROSSA x3
X UNhA CoOatPERgTA DiI ukLAzNA RwOSlvxSA TRE CoOaPyyRyTA DiI ukRAzzNA GRwOSljxSA Alcune mutazioni cambiano il senso altre mutazioni non lo cambiano Sequenze di DNA Seq1
Seq2
Seq3
Seq4
ACA--ACACGG
ACATGG
TCATGG
ATA
ATA
ATA
ATA
CGT
CGT
TGT
CGT
AGC
AGC
AGC
AGC
CAA
CAC
CAA
CAC
ATG
ATG
ATG
ATG
ATA
ATA
ATG
ATA
CAG
CAG
--CAG
ATA
ATA
ATA
ATA
TTG
TTG
TTG
TTG
ACAGAT
ACGAAT
ACAGAT
ACAGAT
DNA codificante ( -­‐> proteina) C’è variabilità gene0ca tra individui, tra popolazioni, tra specie (divergenza) Cosa capita ad una mutazione? La probabilità che una nuova mutazione neutrale si fissi in una popolazione è: 1
Pfix =
2N
e in generale Pfix = p , dove p è la frequenza dell’allele (variante) nella popolazione La probabilità che venga persa è # 1 & 2N
Ploss = % 1 − ( che può essere approssimata in Ploss ≈ e −1 = 0.3679
$ 2N '
Il tempo perché si fissi è Tfix ≈ 4N e
€
Cosa capita ad una mutazione? La probabilità che una nuova mutazione vantaggiosa si fissi in una popolazione può essere approssimata in fix
2
e può fissarsi in T
≈
ln(2N
) generazioni. fix
e
s
Quindi mutazioni anche se molto vantaggiose hanno poche possibilità di fissarsi: per esempio ad s = 0.1 corrisponde una probabilità di fissazione del 2%. In altre parole, la maggior parte delle €
mutazioni vantaggiose vengono perse… €
P ≈ 2s
Perché la dimensione N di una popolazione è importante In popolazioni di piccole dimensioni (incluse quelle con tanto inbreeding) la deriva gene0ca (il “caso”) ha il sopravvento sulla selezione naturale. Più probabilità di fissare mutazioni deleterie Perché la dimensione N di una popolazione è importante Allele A1
ATACGTAGCCAAATGATACAGATATTG
Allele A2
ATACGTAGCCATATGATACAGATATTG
* * * * * * * * * * * * * * * * * * * * Generazione 0 * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Generazione 1 Generazione 2 … Perché la dimensione N di una popolazione è importante 0.6
0.4
0.2
0.0
Frequenza di A1
0.8
1.0
N = 750 0
20
40
60
no. di generazioni
80
100
Perché la dimensione N di una popolazione è importante 0.6
0.4
0.2
0.0
Frequenza di A1
0.8
1.0
N = 100 0
20
40
60
no. di generazioni
80
100
Perché la dimensione N di una popolazione è importante 0.6
0.4
0.2
0.0
Frequenza di A1
0.8
1.0
N = 20 0
20
40
60
no. di generazioni
80
100
I “colli di bo/glia” aumentano la deriva gene0ca e diminuiscono la variabilità gene0ca oulot d’étranglement
(bottleneck)
DUCTION A LA GENETIQUE DES POPULATIONS
p
N
temps
INTRODUCTION A LA GENETIQUE DES POPULATIONS
Migrations:
L’evoluzione di una singola popolazione Densité:
dipende a
nche dal asso i m50igrazione (e individus/Ha
0 t10
20 30d40
situation réaliste
:
quindi pd(A)al s0 uo isolamento) 0.2 0.4 0.6 0.8 1
57
Scarica
Random flashcards
geometria

2 Carte oauth2_google_01b16202-3071-4a8d-b161-089bede75cca

CRANIO

2 Carte oauth2_google_d7270607-b7ab-4128-8f55-c54db3df9ba1

blukids

2 Carte mariolucibello

il condizionale

2 Carte oauth2_google_2e587b98-d636-4423-a451-84f012b884f0

economia

2 Carte oauth2_google_89e9ca76-2f16-41bf-8eae-db925cb2be4b

creare flashcard