Diapositiva 1 - Istituto Superiore di Sanità
annuncio pubblicitario
Aspetti molecolari di Klebsiella pneumoniae resistente ai carbapenemi Alessandra Carattoli Istituto Superiore di Sanità, Roma in breve 1. 2. 3. 4. a) b) c) d) Meccanismo d’azione beta-lattamici Meccanismi di resistenza ai carbapenemi Tipizzazione molecolare dei ceppi Le carbapenemasi di successo VIM-1 OXA-48 KPC NDM-1 Meccanismo d’azione dei beta-lattamici interazione con proteine della sintesi del peptidoglicano (transpeptidasi, endopeptidasi e carbossipeptidasi) “penicillin binding proteins” LPS PORINA PBP Spazio Periplasmico GRAM + GRAM - + Resistenza ai carbapenemi in Klebsiella pneumoniae MEM Hodge Test 1- Produzione di beta-lattamasi e ridotta permeabilità al farmaco Produzione di beta-lattamasi e ridotta permeabilità al farmaco MW ETP R MEM R IMP I ETP R WT 82644937- Ceppi ESBL ERT IMP MEM ERT-R POS R≥8 R≥8 R≥8 ERT-R POS R≥8 S≤1 S=1 ERT- S POS S ≤ 0.5 S≤1 S ≤ 0.5 -porina 2619- Outer membrane proteins (OMPs) porine + Resistenza ai carbapenemi in Klebsiella pneumoniae MEM Hodge Test 2- Produzione di carbapenemasi b-lactamasi Penicillins Early generation cephalosporins Second and b-lactam/ Carbapenems third b-lactamase generation inhibitor cephalosporins combinations ESBL SHV, TEM, CTX-M Metallo-beta Lattamasi Cephalosporinasi, o AmpC KPC, GES IMP, VIM, NDM CMY, FOX, MOX, LAT Oxacillinase OXA1 OXA48 OXA58 OXA23 a) Identificazione geni delle carbapenemasi.- PCR- sequenza Primer IMP-F Sequence, 5′ → 3′ GGAATAGAGTGGCTTAAYTC IMP-R TCGGTTTAAYAAAACAACCACC VIM-F GATGGTGTTTGGTCGCATA VIM-R CGAATGCGCAGCACCAG OXA-48-F GCGTGGTTAAGGATGAACAC OXA-48-R CATCAAGTTCAACCCAACCG NDM-F GGTTTGGCGATCTGGTTTTC NDM-R CGGAATGGCTCATCACGATC KPC-Fm CGTCTAGTTCTGCTGTCTTG KPC-Rm CTTGTCATCCTTGTTAGGCG Gene blaIMP Product size, bp 232 blaVIM 390 blaOXA-48 438 blaNDM 621 blaKPC 798 Plasmidi : Molecole di DNA circolari extracromosomali che replicano autonomamente dal cromosoma batterico Non portano geni essenziali per la vita del batterio, ma geni accessori (resistenze) di cui promuovono il trasferimento orizzontale nuc tnpA IS26 aacA4 blaVIM-1 intI1 uvp1 hyp hyp DLocus Tra KJI EcoRII kikA korB korA blaSHV-12 tnpA IS26 tnpR tnpA tnpM int1 dfrA14 hyp IS6100 tnpA IS26 DIS26 qnrS1 DfipA IncN rep ardK mpr mucB mucA ardB ardR ccgEIII ardA ccgAI ccgAII stbC stbB stbA oriT DLocus Tra L MABCDENOFG korA korB kikA EcoRII uvp1 Locus Tra KJI IS6100 tnpA nuc IS6100 IS26 int1 blaVIM-1 aacA7 dfr1 aadA1 IS26 tnpA tnpA IS1222 IS903B strB strA IS1133 int1 dfr1 aadA1 IS1 IS26 aph IS26 int1 dfrA12 aadA2 Mer locus tnpA DfipA IncN rep ardK mpr mucB mucA ardB ardR ccgEIII ccgD ccgB ardA ccgAI ccgAII stbC stbB stbA oriT DLocus Tra VIM-1: Epidemia di un plasmide IncN Nordmann et al. EID 17, 2011 pNL194- VIM-1 GFOENDCBAM L pKOX105- VIM-1 VIM-1 Elementi mobili Altri geni di resistenza Replicazione Geni plasmidici (Miriagou et al 2010, Carattoli et al. 2010) Oxa-48: Epidemia di un plasmide IncL/M Nordmann et al. EID 17, 2011 pOXA-48a Locus Tra excA korC ssb mobC mobA nikB nikA resolvase parA parB nuc pemI, pemK mucA mucB lysR blaOXA-48 IS1999 IS1999 trbC,B,A,N HIJK priLMNOPQRUWXY IncL/M rep Klebsiella pneumoniae, 61,881 bp JN626286 K. pneumoniae KPC-positive 2010-2011 % di ceppi isolati Ceppi ES-Kp 70 Ceppi ER-Kp 60 Ceppi KPC-3-Kp 50 40 30 20 10 0 Giugno 2008 Dicembre 2009 Ottobre 2010 - Maggio 2011 Tipizzazione dei ceppi TYPING MLST: Basato sulle sequenze 7 Geni housekeeping Potere discriminante moderato Brisse et al. PlosOne 2009 FINGERPRINTING AFLP, PFGE: Basato sulle bande Genoma intero Potere discriminante alto Tipizzazione dei ceppi ST512/ST258 MK gap infB mdh pgi phoE rpoB tonB ST 2 9 2 1 13 1 16 37 54 3 1 1 1 1 79 512 3 3 1 1 1 1 79 258 Multi Locus Sequence Typing (MLST) PCR e sequenza di 7 geni conservati ST37 Multiplex Real-Time PCR for Detection of an Epidemic KPCProducing Klebsiella pneumoniaeST258 Clone Chen et al. Antimicrob. Agents Chemother.June 2012 vol. 56 no. 6 3444-3447 Pulsed Field Gel Electrophoresis (PFGE) IS6100 dfrA14 intI1 tnpM tnpR uvp1 EcoRII korA korB kikA GFOENDCB finO WU N FQ trbB trbF trbE MJY ALEKBPV trbC tnpA arsC arsB arsA arsD arsR DLocus Tra KJI trbI oriT P12-KPC-3 tnpA tnpA ISkpn7 blaKPC-3 ISkpn6 tnpA tnpA nuc IncN rep ardK mpr mucB mucA ardB ardR ccgEIII hyp ccgAI ccgAII stbC stbB stbA oriT DLocus Tra DfipA tnpA IS26 tnpA tnpA sul1 aph DtnpA tnpA blaTEM blaOXA-9 aadA1 aacA4 res Tn3 excA ISEc8 pndR ISkpn6 blaKPC-2 ISkpn7 tnpA tnpR Glut. locus tnpA ISkpn7 blaKPC-2 ISKpn6 tnpA uvp1 tnpR korA korB kikA EcoRII Locus Tra fipA nuc IncN rep ardK mpr mucB mucA ardB ardR ccgEIII ccgD ccgC ardA ccgAI stbC stbB stbA oriT KJI TypeI restr parB parA FIBK rep umuC umuD stbA stbB DNA meth. ardB ardA ssb parB IS1 Tox-AntiTox res tnpA res tnpA Locus mer IS26 blaTEM-1 tnpA FII K2 rep res tnpA ISKpn7 blaKPC-3 ISKpn6 tnpA tnpA tnpA KPC- in un trasposone P9-KPC-2 GFOENDCBAM L (Gootz et al. 2009) KPC AM L HGSTDIX (Gootz et al. 2009) pKpQIL (Leavitt, et al. 2010) moB moC ropB relE M-transf Tn3 tnpA Tn3 tnpR aac6 IS26 cloacin aminoglicosidi KPC Elementi mobili Altri geni di resistenza macrolidi arsenico ColEST258, Italy, 13640 bp, JN247853 Replicazione Geni virulenza Geni plasmidici rame e argento EKBPV WU N FQ finO trbB trbF trbE MJY trbC finO trbB trbF HGSTDIX trbI oriT tnpA WU N FQ finO trbB trbF trbE trbC trbI oriT WU N FQ parB SOS umuC umuD Rev transcr ssb trbE MJY ALEKBPV trbC trbI oriT TypeI restr parB parA FIBK rep umuC umuD stbA stbB DNA meth. ardB ardA ssb parB IS1 Tox-AntiTox res tnpA res tnpA Locus mer IS26 blaTEM-1 tnpA FII K2 rep res tnpA ISKpn7 blaKPC-3 ISKpn6 tnpA tnpA tnpA MJY ALEKBPV IS903 FIB rep sopA sopB tnpA Locus silver Locus copper tnpA tnpA Locus Ars TypeI restr parB parA FIBK rep umuC umuD stbA stbB DNA meth. ardB ardA ssb parB IS1 Tox-AntiTox res tnpA res tnpA KPC-3 Locus mer IS26 aph IS26 blaTEM-1 tnpA FII K2 rep res tnpA ISKpn7 blaKPC-3 ISKpn6 tnpA tnpA pKpQIL, IS66 IS1 cat Tn21 intI1 dhfrA12 aadA2 sul1 IS6100 mrx mphA IS26 ABC IS5 IS1 tnpA ABC glut Iron(3)uptake FII K1 rep IS903D lacY, Z, I Plasmidi di K. pneumoniae ST258 Garcia-Fernandez et al. 2012 AAC 56(4):2143-5 Israel, 113637 bp, NC_014016 Leavitt, et al. 2010. Antimicrob. Agents Chemother. 54: 4493-4496. mercurio pKpQIL, Italy, 114986 bp, JN233705 HGSTDIX Iron (3) uptake, ABC transporter trimethoprim, sulfonamidi, streptomicina, cloramphenicolo pKPN-IT, Italy 208193 bp, JN233704 HGSTDIX KP e New Delhi Metallo Beta Lactamase Epidemia di un gene: NDM-1 Elementi Cloni diversi mobili diversi Giske C G et al. Antimicrob. Agents Chemother. 2012;56:2735-2738 Tn7 rhs delta insE groEL groES dsbC trpF bleMBL blaNDM-1 ISKpn14-like DIS30 aphA6 istA tniA DtniB tnpA aac3 insA insB rmtC nth dmc sul1 qacDE1 aac(6’)-Ib intI1 Tn21tnpR Tn21tnpA IS4321 DNApri IncA/C rep stbA traG traH traF elicase ter exonuclease phage- int hsdM hsdS elicase hsdR excisionase RmtC sulfonamidi, aminoglicosidi NDM-1 Elementi mobili Altri geni di resistenza parB dsbA sppA DNApolIII DNA methylase Methyl-transferase korB parA DNA methylase DANpolIII DNA methylase ISEc23 sugE blc blaCMY-6 ISEcp1 hyp dsbC parB dsbA sppA korB parA DNA methylase Methyl-transferase sulfonamidi, aminoglicosidi, cloramphenicolo, eritromicina, rifampina parB dsbA sppA hyp sugE blc blaCMY-4 ISEcp1 traN traU traW trhF traC dsbC traN traU traW trhF traC ATPase ssb ybA Phage- hyp Phage- hyp ngrC rhs delta groEL groES Oxidoreductase bleMBL blaNDM-1 ISKpn14 rmtC Methyl-transferase endonucIII sul1 cmlA aadA ereA arr2 intI1 Tn1696tnpR Tn1696tnpA IS4321 DNApri Tn7 phage- int TypeI restriction nuclease Type I restriction recF hsdR traG traH traF ter yacC stbA IncA/C rep 16SKenya, rRNA methylase RmtC IncA/C pNDM-KN, Klebsiella pneumoniae, 162746 bp, JN157804, Carattoli et al. 2011 DNApolIII DNA methylase Methyl-transferase korB parA DNA methylase hyp sugE blc blaCMY-2 ISEcp1 ATPase ssb DNA restriction Phage- hyp ybA DNA methylase DNA methylase ArmA ssb ATPase traN traU traW trhF traC dsbC NDM-1 ngrC rhs IS4321R merR Tn3tnpA Tn3tnpR blaTEM-1 IS903 blaNDM-1 bleMBL trpF DgroES groEL insE IS903 IS1 tnp mph2 mel tnpD IS5 armA IS5 sul1 qacDE1 aadA2 dfrA12 intI1 Tn1696tnpR Tn1696tnpA IS4321L DNApri Tn7 IncA/C rep stbA traG traH traF elicase kfrA exonuclease phage- int TypeI restriction Type I restriction hsdR I plasmidi più diffusi con NDM-1 CMY Locus Tra IncA/C pNDM-1_Dok01, Escherichia coli , Japan, 195560 bp, AP012208, Sekizuka et al. 2011 Locus Tra IncA/C pNDM10505, Escherichia coli , Canada, 166744 bp, JF503991, Boyd et al. 2011 Locus Tra Replicazione Metilasi, restrizione Geni plasmidici Conclusioni •Clone dominante ST37 con difetto di porine e produzione ESBL fino alla comparsa del primo ceppo di K. pneumoniae positivo per KPC-3 •Produttori di carbapenemasi hanno sopraffatto quelli ESBL-porine mutanti •Espansione di un clone di successo: epidemia KPC-3::ST258 • Tipizzazione molecolare necessaria ma in caso di ceppo clonale insufficiente • Diffusione orizzontale dei geni delle carbapenemasi mediata da plasmidi • L’associazione fisica di geni che conferiscono resistenza a classi diverse di antibiotici sui plasmidi viene positivamente selezionata da ognuno dei singoli antibiotici codificati • Epidemia di geni (NDM-1), di plasmidi (VIM-1, OXA48), di cloni (KPC-3::ST258)
